situ hybridization probe sequences Search Results


86
Eurofins ccttcaactcctcaagatctacttgcc eurofins scientific n a primer
Ccttcaactcctcaagatctacttgcc Eurofins Scientific N A Primer, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ccttcaactcctcaagatctacttgcc eurofins scientific n a primer/product/Eurofins
Average 86 stars, based on 1 article reviews
ccttcaactcctcaagatctacttgcc eurofins scientific n a primer - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

90
Shanghai GenePharma probes and rna in situ hybridization kit
Probes And Rna In Situ Hybridization Kit, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/probes and rna in situ hybridization kit/product/Shanghai GenePharma
Average 90 stars, based on 1 article reviews
probes and rna in situ hybridization kit - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Ribobio co lncrna fish probe and fluorescent in situ hybridization kit
Lncrna Fish Probe And Fluorescent In Situ Hybridization Kit, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lncrna fish probe and fluorescent in situ hybridization kit/product/Ribobio co
Average 90 stars, based on 1 article reviews
lncrna fish probe and fluorescent in situ hybridization kit - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
TIB MOLBIOL sequence-specific hybridization probes
Sequence Specific Hybridization Probes, supplied by TIB MOLBIOL, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sequence-specific hybridization probes/product/TIB MOLBIOL
Average 90 stars, based on 1 article reviews
sequence-specific hybridization probes - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
ZytoVision gmbh zytolight rat y/12 fluorescence in situ hybridization (fish) y- chromosome probe
Zytolight Rat Y/12 Fluorescence In Situ Hybridization (Fish) Y Chromosome Probe, supplied by ZytoVision gmbh, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/zytolight rat y/12 fluorescence in situ hybridization (fish) y- chromosome probe/product/ZytoVision gmbh
Average 90 stars, based on 1 article reviews
zytolight rat y/12 fluorescence in situ hybridization (fish) y- chromosome probe - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
ZytoVision gmbh syt dual color break apart probe-based fluorescence in situ hybridization (fish) test z-2097-50
Syt Dual Color Break Apart Probe Based Fluorescence In Situ Hybridization (Fish) Test Z 2097 50, supplied by ZytoVision gmbh, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/syt dual color break apart probe-based fluorescence in situ hybridization (fish) test z-2097-50/product/ZytoVision gmbh
Average 90 stars, based on 1 article reviews
syt dual color break apart probe-based fluorescence in situ hybridization (fish) test z-2097-50 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
BlueGnome Limited fluorescent in situ hybridization probes
Fluorescent In Situ Hybridization Probes, supplied by BlueGnome Limited, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/fluorescent in situ hybridization probes/product/BlueGnome Limited
Average 90 stars, based on 1 article reviews
fluorescent in situ hybridization probes - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Ribobio co sirna targeting human lncrna snhg8
Sirna Targeting Human Lncrna Snhg8, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sirna targeting human lncrna snhg8/product/Ribobio co
Average 90 stars, based on 1 article reviews
sirna targeting human lncrna snhg8 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Metabion International AG sequence-specific hybridization probes (0.3 µm per reaction) 5′- aggatacg aatgtgcagctgac -fl
Sequence Specific Hybridization Probes (0.3 µm Per Reaction) 5′ Aggatacg Aatgtgcagctgac Fl, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sequence-specific hybridization probes (0.3 µm per reaction) 5′- aggatacg aatgtgcagctgac -fl/product/Metabion International AG
Average 90 stars, based on 1 article reviews
sequence-specific hybridization probes (0.3 µm per reaction) 5′- aggatacg aatgtgcagctgac -fl - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
EXONBIO Inc mirna in situ hybridization probes specific for human mir-548a-3p
Mirna In Situ Hybridization Probes Specific For Human Mir 548a 3p, supplied by EXONBIO Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mirna in situ hybridization probes specific for human mir-548a-3p/product/EXONBIO Inc
Average 90 stars, based on 1 article reviews
mirna in situ hybridization probes specific for human mir-548a-3p - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Oncor Inc fluorescence in situ hybridization n25 probe
Fluorescence In Situ Hybridization N25 Probe, supplied by Oncor Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/fluorescence in situ hybridization n25 probe/product/Oncor Inc
Average 90 stars, based on 1 article reviews
fluorescence in situ hybridization n25 probe - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Ribobio co a fluorescence in situ hybridization kit and probes
A Fluorescence In Situ Hybridization Kit And Probes, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/a fluorescence in situ hybridization kit and probes/product/Ribobio co
Average 90 stars, based on 1 article reviews
a fluorescence in situ hybridization kit and probes - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

Image Search Results